Банки информации

  • View
    27

  • Download
    3

Embed Size (px)

DESCRIPTION

. .. 11 /III 2006. . . gatcaacactacttgacttcaagacttaccataaagaaaactatagtgtggtattggcaa aagacaagacaaatagatcaacataacaaaataaagggccatgaaatagacccatatagt - PowerPoint PPT Presentation

Transcript

  • .. 11/III 2006

  • gatcaacactacttgacttcaagacttaccataaagaaaactatagtgtggtattggcaaaagacaagacaaatagatcaacataacaaaataaagggccatgaaatagacccatatagtcaattgatttttgacaaagaaggattggcaatagaatggggtaaagatagtcttctcaacaaacggtaccagaatgactgaatacccacatgcaaaaagaaaaagaaatgaacctagacacagatcttatacagttcacaaaaatgtaactcaaaatgaatcatagacctaaatataatattcaagactataaaaccctaaaatataacataggggaaaatctaaacaatcttgagtttgttaatgactttttagatacaataccaaaggcaggatccaggaaagaatcgataagctgggcttcattaaaattaaaatatttctgctctatgaagccactgtcaagagaaggaaaaggcaagccatagactgggagaaaatatttacaaaagacatacatgataaaggactattatccaaaatgtacaaagaactctaaaaaacttaacaataagaaaacaaacccaactaaaaactgggccaaagatcttaacagatatattaccaaagaagatacacagatggcaaataagcataaaaagattaaccacatcatacgtcattaagaaattgcaaattaaaacaacaatgagacaccattatacacctagtagaatgacccaaatccagattactgacataatcaaatgctgacaaggatgtggagaaacaggaactgccattcttgggttgtgggaatgccaaatggtatgcctgctttggaagacagcttggtggtttcttacaacactaagcatactcttaccaaaagatcgagca

  • - ... : ( )

  • A C G TC N O P

  • CGCCATAAATCAC

  • !~ 0,00001

  • 1970- ...CGCCATAAATCAC...

  • ()gatcaacactacttgacttcaagacttaccataaagaaaactatagtgtggtattggcaaaagacaagacaaatagatcaacataacaaaataaagggccatgaaatagacccatatagtcaattgatttttgacaaagaaggattggcaatagaatggggtaaagatagtcttctcaacaaacggtaccagaatgactgaatacccacatgcaaaaagaaaaagaaatgaacctagacacagatcttatacagttcacaaaaatgtaactcaaaatgaatcatagacctaaatataatattcaagactataaaaccctaaaatataacataggggaaaatctaaacaatcttgagtttgttaatgactttttagatacaataccaaaggcaggatccaggaaagaatcgataagctgggcttcattaaaattaaaatatttctgctctatgaagccactgtcaagagaaggaaaaggcaagccatagactgggagaaaatatttacaaaagacatacatgataaaggactattatccaaaatgtacaaagaactctaaaaaacttaacaataagaaaacaaacccaactaaaaactgggccaaagatcttaacagatatattaccaaagaagatacacagatggcaaataagcataaaaagattaaccacatcatacgtcattaagaaattgcaaattaaaacaacaatgagacaccattatacacctagtagaatgacccaaatccagattactgacataatcaaatgctgacaaggatgtggagaaacaggaactgccattcttgggttgtgggaatgccaaatggtatgcctgctttggaagacagcttggtggtttcttacaacactaagcatactcttaccaaaagatcgagca

  • 1982 GenBankGenBank

    GenBank:1982: 680 338 606 1992: 101 008 486 78 608 2002: 28 507 990 166 22 318 883 2004: 44 575 745 176 40 604 319 2005: 56 037 734 462 52 016 762 ( ~165 000 ) 196 Gb

  • International Nucleotide Sequence Database Collaboration

    GenBank ()EMBL ()DDBJ ()

  • GenBank

  • GenBank GenBank ?: 1) ;2) ( , , ..)

  • GenBank (fields) : , , ( ), , . ( ) .

  • GenBank? (, SRS Entrez), . , ( ). , .

  • gene DEFINITIONyeast ORGANISMIvanov AUTHORSyeast ORGANISM tRNA DEFINITIONmouse rat ORGANISM

  • ? 52 . , , . !

  • :

  • ? (, , , ). (, , .). . , , ..

    ?

  • ? (, , , ). (, , .). . , , ..

  • ( ) ( )

  • (, ) ( )

  • RRNFSKQASE ILNEYFYSHLSNPYPSEEAK EELARKCGITVSQVSNWFGN KRIRYKKNI

  • GenBank, EMBL, DDBJRefSeq SwissProt PDB ...