Сравнительный анализ последовательностей ДНК

  • Published on
    14-Jan-2016

  • View
    50

  • Download
    0

Embed Size (px)

DESCRIPTION

. 4 2005. . = > () , - PowerPoint PPT Presentation

Transcript

  • 4 2005

  • => () , , , Etc. CRITICA: () =, ,

  • : (Procrustes, GeneWise) (BLAST) (GenomeScan): , , ( ) , - (Rosetta, SGP) (Pro-Gene , DoubleScan HMM +, SLAM).

  • , ,

  • HMM (DoubleScan)

  • Phylogenetic footprinting . MENTERIC, Gibbs samplersPhylogenetic footprinting . rVISTAPhylogenetic shadowing (consistency check).

  • Low conservation in upstream region

    yjcD

    ST AAA-GCATAAAAAGCGGCAAAGTTCAGTTGAAAAAGCGTTGATGATCGCTGGATAATCGTTTGCTTTTTTTTG---CCAC

    EC AAA-GAGAAAAAAGCAGCAAACTTCGGTTGAAAAAGCCGCTATGATCGCCGGATAATCGTTTGCTTTTTTTA----CCAC

    YP AAATGTATTAAATGTCGCATTCGGGTGTTGATTAGTCACCACTGATGGCTAGATAATCGTTTGCCTTAAATGACATCTGC

    *** * *** * *** ***** * * **** ** ************* ** * * *

    ST CC--------GTTTTGT--------ATACGTG----GAGCTAAACGTTTGCTTTTTTGCGGCGCCCCG-G-TTGTCGTAA

    EC CC--------GTTTTGT--------ATGCGCG----GAGCTAAACGTTTGCTTTTTTGCGACGCAGCA-AATTGTCGCAA

    YP CCTAAACTTCGATTTTTTTTCAGTCATGCGTTCTCCCAGCTAATCGTTTGCTATTTTTCCCCGCTCTATGAGTCAGGGAG

    ** * *** * ** ** ****** ******** **** * *** * * *

    ST ATGTAGC----------ACAAGGA-GATAACGTTGCGCTGTTAGTGGATTACCTCCCACGTATACCGACGAATAATAAAT

    EC ACCTGGA----------GCAGGAA-GATAACGTTTCGCTGGCAGGGGATTGTCCGCCACGCATCTTGACGAAAATTAAAC

    YP AGTTAGTGAGTTCATCGACAGGAACGGAAACGATTACGTAGAGAAGGGCGCTTGGCTTGGCATGCTATTTTAAAATGA-C

    * * * ** * * * **** * * ** * * ** * * * *

    ST TCTCAGGGGATGTTTTCT-ATGTCT------ACGCCTTCAGCGCGTACCGGCGGTTCACTCGACGCCTGGTTTAAAATTT

    EC TCTCAGGGGATGTTTTCTTATGTCT------ACGCCATCAGCGCGTACCGGCGGTTCACTCGACGCCTGGTTTAAAATTT

    YP ACACAGGGGACATCACC--ATGTCTAGCAGCAACCCTCAAGCACAGCCAAAGGGCACGCTTGATGCATTCTTTAAGCTTA

    * ******* * * ****** * ** *** * * ** * ** ** ** * ***** **

  • High conservation in upstream region

    purL

    ST AGCGGCATTTTGCGTAACAATGCGCCAGTTGGCAACTT-ATT-CGCAACGATAGCCGCACC--GTATGACAAGAAAAAGC

    EC AGCGGCATTTTGCGTAAACCTGCGCCAGATGGCAACTT-ATT-ACAGCCATTGGCGGCACG--CGTTGCTAATTCACGAT

    YP AGTGGCATTTTGCGCAACAAAACGCCAGTGTGCAACTTTATTGCGAGCTATTTGCTGAGTCTGCGTTACACACACATAGC

    ** *********** ** ****** ******* *** * ** * * * *

    ST GG-TGATT---------TTATTTCT-------ACGCAAACGGTTTCGTCGGCGCGTCAGATTCTTTATAATGACGGCCGT

    EC GG-TGATT---------TTATTTCC-------ACGCAAACGGTTTCGTCAGCGCATCAGATTCTTTATAATGACGCCCGT

    YP GGCTGTTTCTGACTGAATTATTAATAATAGATACGCAAACGGTTTCGTCGGCGGCTCAGATTCACTATAATGGCGCGCGT

    ** ** ** ***** ***************** *** ******** ******* ** ***

    ST TTCCCCCC-------------------TTGCGCACACCAAA--------------GCTTAGAAGACGAGAGA--CTTA--

    EC TTCCCCCCC------------------TTGGGTACACCGAAA-------------GCTTAGAAGACGAGAGA--CTTA--

    YP TTTGCCCTGTTGTTGCGCCAATGAATGTTGCGCCCAATGAAGTGCTGTTCCAGCCGCTTCGAAGACGAGAGAAACTTAGA

    ** *** *** * ** ** **** ************ ****

    ST TGATGGAAATTCTGCGTGGTTCGCCTGCACTGTCTGCATTCCGTATCAATAAACTGCTGGCGCGCTTTCAGGCTGCCAAC

    EC TGATGGAAATTCTGCGTGGTTCGCCTGCACTGTCGGCATTCCGAATCAACAAACTGCTGGCACGTTTTCAGGCTGCCAGG

    YP TTATGGAAATACTGCGTGGTTCACCCGCTTTGTCGGCTTTTCGTATCACCAAACTGTTGTCCCGTTGCCAGGATGCTCAC

    * ******** *********** ** ** **** ** ** ** **** ****** ** * ** * **** ***

  • Menteric

  • Multiple sites (nrd genes): FNR, DnaA, NrdR

  • nrdD:.DnaAFNR NrdR

  • Phylogenetic Shadowing (E.Rubins lab)

  • apo(a)

  • Consistency filtering: the basic procedureGenome 2Genome 1Genome N

  • Accounting for the operon structure

    Old genome

    New genome

    A

    A

    BC

    BC

    D

    XD

    EF

    E

    F

    X

    X

    X

    X

  • Regulogger (W.Wasserman): ?

  • ~22 (, 3- ; , - ) () , ~70 . 800 ( > 200), 200, 100, (.. ) ?

  • shadowing (, - ), -

Recommended

View more >