Индексирование текста для поиска с учетом орфографических ошибок

  • Published on
    18-Mar-2016

  • View
    49

  • Download
    2

Embed Size (px)

DESCRIPTION

. 2006 . 0 . I - . . . - PowerPoint PPT Presentation

Transcript

  • 2006 .

  • 0

  • I -

  • : :

  • (1) n P m d :

  • (2) ,

  • :GACTCAAAACGGGTGCGTGACCGACGGATGACCCTACAAACATGTTCGTAAACCTGAGACCAAC

    : ACAAC : d = 1

  • :GACTCAAAACGGGTGCGTGACCGACGGATGACCCTACAAACATGTTCGTAAACCTGAGACCAAC

    : ACAAC : d = 1

    : 1- : (6, 10), (7, 10) 3- : (4, 7), (4, 8), (4, 9), (6, 9)4- : (2, 5), (11, 16), (12, 16), (13, 16)

  • :GACTCAAAACGGGTGCGTGACCGACGGATGACCCTACAAACATGTTCGTAAACCTGAGACCAAC

    : ACAAC : d = 1

    : 1- : 6, 7 3- : 4, 64- : 2, 11, 12, 13

  • :GACTCAAAACGGGTGCGTGACCGACGGATGACCCTACAAACATGTTCGTAAACCTGAGACCAAC

    : ACAAC : d = 1

    , : 1, 3, 4

  • (1)

  • (2)

  • II minpref l-

  • d(u,v) = , , u v. :d(u[1..i],v[1..j]) =d(u[1..i],v[1..j-1])+1, =mind(u[1..i-1],v[1..j])+1, d(u[1..i-1],v[1..j-1])+u[i],v[j]

  • (2):d(, ) = 3 O((|u|+|v|)*k) min(d(u,v),k) [ 1985]

  • minprefu(v)minprefu(v) = min l:d(prefl(u),prefl+|u|-|v|(v)) = d(u,v)suffl+1(u) = suffl+|u|-|v|+1(v):minpref() = 4AAd(,)=3

  • minpref d(u,v)=k u(i) u i k minprefu(i)(u) > h + 1, j > h prefj(v)=prefj(u(i-1)):i = 2minprefu(2)(u)=3h = 1j = 2pref2(v)=pref2(u(1))

  • l- l l- 2- :

  • A n . i j. f(n) g(n)

  • (2)RMQ Range Minimum Query (i, j) c l, A[l] = min{A[k], ikj} - RMQ :

  • (3)BVRQ Bounded Value Range Query (i, j, k) l, ilj A[l]kCRQ Colored Range Query (i, j) A[l] ilj

  • III - - d = 1

  • - 1: s T. O(|P|d) P. 2: , T d. P O(|P|).

  • - ? 1: T - 2:

  • -: O(|P|).: P , T.

  • d = 1 S , , h0 S. P T ( ), P S. P T , : h0- , .. minprefs(P) > h0 h0- (), .. minprefs(P) h0 s T, P.

  • d = 1minprefs(P) > h0 P S P ( 1)

  • d = 1minprefs(P) h0 , T , , h0. 2|| S O(h0) S h1 S P

  • P s S d prefh0(P)=prefh0(s), S , 1, O(|P|d) .: S r, P .

  • (2) :minprefs(r)>h1 S , 1minprefs(r)h1 , S h1 . O(h1) . S P .

  • P

    O(m) ,

    O(m + dm)

  • (2) P

    O(m + occ):O(m + occ)

    d ||

  • : O(h0h1hd-1|S|) : O(h0h1hd|S|)hi=O(log n)

  • O(occ) , A / , A A O(occ) CRQ

  • (2)RQ BVRQ B:B[i] = A A[i], -1, CRQ- (i,j) BVRQ- (i,j,i-1) B.

    AB

  • (3)BVRQ RMQ: (2,7,6):

    244

  • IV - - - , O(m+occ) ( ) , ?