• Published on

  • View

  • Download


2 1. .coli rRNA 55 . mRNA .coli; 2. 5 snRNA 145 . mRNA ; 3. DNA .coli 4*106 . .coli 32. 20 , : ) DNA 40 ) DNA ; 4. DNA 1400 . 2 DNA, 13480 DNA . DNA . 5. mRNA DNA 30% , 30% G, 20% C. ; 6. DNA : 3 AAATTTTACTGCATAATGATTCCG-5 5 TTTAAAATGACGTATTACTAAGGC-3 ) . ) mRNA DNA. ) mRNA. 7. mRNA : 5 AUGGUGCACCAGAGUCCUGAGGAGAAGUAA 3 : ) DNA . ) mRNA. ) DNA. ) DNA. 8. DNA : ATGCCTCATCGTTGTAGTGGTGATGCTGTTTGA. ) mRNA. ) mRNA : --- --, ( ) ) mRNA. 9. mRNA 6000 , , 989 . 17

3 5 mRNA. 10. mRNA 9 5 8 3 , 160 . mRNA 20% mRNA . 1525 . ; 11. , 46 . , . DNA mRNA 12 ; ( 3 5 ) 12. .=10320. 748 . , . . 120 . 2 18. 13. 2560 . mRNA, 20%. 5 3 9 5 ( ). 14. 90 . mRNA 3084 ,, . ) mRNA ; ) . 100, . ; . 15. : : UGAAUTCCATGA G T G A C T T A A G G T A C T G C A , ; 5 3 . 16. : CCGTGCTTTTATGCGT.417 TGGTAAATACCCGTCTT ) ) . ) 5 3 . ) tRNA mRNA , .


17. DNA : TTTAAAAAGTACGGCAGCGCGTCCCACATCTTTAAA tRNA mRNA ; 18. 1900 . 3 , 20200 . . 19. 100 . . 709 . . 3 5 mRNA . 20. RNA 15000 10% 20% . 40000, RNA . 21. DNA . : 18% , 24% , G 16%. : ) ) DNA. ) RNA . 22. : ) . ) DNA mRNA. ) - - , . G C P H E U T T T mRNA DNA

23. 3600 26 . mRNA 1/3 mRNA 608 . : ) . ) . 19

) ; ) 5 3 mRNA, 7 . 24. DNA . DNA 4800000 , 4000000. DNA 200000 , ; 25. DNA : 3 C G C T A C A T G T C A A T A G A G C C A G G C A C T T A A A T 5 ) DNA. ; ) mRNA . 26. 3.1

5 1 2 2



DNA . ) . ) 1 3000 , mRNA. mRNA, 60% . mRNA 350 . 5 3 mRNA.




View more >