Association of NLRP3 and CARD8 genetic polymorphisms with juvenile idiopathic arthritis in a Taiwanese population

  • Published on
    12-Jan-2017

  • View
    217

  • Download
    3

Embed Size (px)

Transcript

<ul><li><p>Association of NLRP3 and CARD8 genetic polymorphisms with juvenileidiopathic arthritis in a Taiwanese population</p><p>C-A Yang1, S-T Huang1, B-L Chiang1,2</p><p>Departments of 1Paediatrics and 2Medical Research, National Taiwan University Hospital, Taipei, Taiwan</p><p>Objectives: An elevated interleukin (IL)-1 response in peripheral blood mononuclear cells (PBMCs) has been observedin systemic juvenile idiopathic arthritis (sJIA), suggesting a role for inflammasomes in the pathogenesis of JIA. We aimedto determine whether genetic polymorphisms of the NLRP3 inflammasome components confer risk for oligoarticular andpolyarticular JIA in a Taiwanese population.Method: A total of 118 JIA patients and 103 healthy controls were genotyped for rs4353135 OR2B11/NLRP3 andrs2043211 CARD8 polymorphisms. Clinical laboratory data and serum IL-1 of JIA patients were evaluated by medicalchart review and enzyme-linked immunosorbent assay (ELISA), respectively. The production of IL-17 in lymphocytes ofdifferent genotype carriers was measured using flow cytometry.Results: The variant rs4353135 G allele carrier conferred increased risk for oligoarticular and polyarticular JIA. TheG allele was also found to be associated with higher levels of clinical inflammatory markers. Moreover, G variant carriersenhanced the lymphocyte IL-17 response. The G/G genotype further increased the need for treatment with the tumournecrosis factor (TNF) inhibitor etanercept.Conclusions: Our data indicate that the rs4353135 OR2B11/NLRP3 polymorphism might be functional in, and couldcontribute to, the pathophysiology of oligoarticular and polyarticular JIA in a Taiwanese population.</p><p>Juvenile idiopathic arthritis (JIA) is the most commondebilitating chronic disease of childhood. It is an auto-immune disease with heterogeneous subtypes and com-plex immunopathology. Specific human leucocyteantigen (HLA) alleles have been reported to be associatedwith susceptibility to JIA (1, 2). Non-HLA genetic asso-ciations include interleukin-2 receptor subunit alpha(IL2RA), protein tyrosine phosphatase, non-receptortype 22 (PTPN22), tumour necrosis factor alpha(TNF-), and macrophage migration inhibitory factor(MIF) (37). Elevated plasma levels of TNF and MIFhave been reported in patients with JIA, irrespective ofsubtype (8). Furthermore, enhanced IL-1 response hasbeen observed in systemic JIA (sJIA) (9), and the IL-1antagonist had shown efficacy in treating sJIA (10, 11).The involvement of IL-1 suggests that inflammasomesmay play a role in the pathogenesis of JIA.Genetic polymorphisms in IL-6, IL-18, and the IL-1</p><p>family have been demonstrated to be associated with sus-ceptibility to different subtypes of JIA (1214). However,whether genetic variations of inflammasomes contribute torisk for JIA remains unknown. The NOD-like receptor</p><p>family, pyrin domain containing 3 (NLRP3) and an adaptorprotein containing caspase recruitment domain (CARD) areessential components of the NLRP3 inflammasome, whichregulates caspase 1-mediated IL-1 activation (15, 16). It hasbeen demonstrated that the rs4353135 polymorphism,which is located between the NLRP3 and OR2B11 genes,affects the expression of NLRP3 and susceptibility toanother autoinflammatory disease, Crohns disease (CD)(17). Furthermore, combined genetic polymorphisms ofNLRP3 and CARD8were reported to influence the suscept-ibility and severity of adult rheumatoid arthritis (RA) (18). Itis also likely that functional genetic variations ofNLRP3 andCARD8 play a role in JIA pathogenesis. In our study, wecompared the genotype frequencies of rs4353135 (NLRP3/OR2B11) and rs2043211 (CARD8) variants between JIApatients and healthy controls. The impact of these two singlenucleotide polymorphisms (SNPs) on levels of inflamma-tory markers and treatment responses was also evaluated.</p><p>Method</p><p>Subjects</p><p>A total of 118 JIA patients diagnosed and treated at theNational Taiwan University Hospital between 2004 and2011 were enrolled in this study. The diagnosis and classi-fication of JIA was made according to the InternationalLeague of Associations for Rheumatology (ILAR) revised</p><p>Bor-Luen Chiang, Department of Paediatrics, National TaiwanUniversity Hospital, 7 Chung-Shan South Road, Taipei 100, Taiwan.E-mail: gicmbor@ntu.edu.tw</p><p>Accepted 12 August 2013</p><p>146 Scand J Rheumatol 2014;43:146152</p><p> 2014 Informa Healthcare on license from Scandinavian Rheumatology Research Foundation</p><p>DOI: 10.3109/03009742.2013.834962www.scandjrheumatol.dk</p><p>Scan</p><p>d J </p><p>Rhe</p><p>umat</p><p>ol D</p><p>ownl</p><p>oade</p><p>d fr</p><p>om in</p><p>form</p><p>ahea</p><p>lthca</p><p>re.c</p><p>om b</p><p>y Im</p><p>peri</p><p>al C</p><p>olle</p><p>ge L</p><p>ondo</p><p>n on</p><p> 06/</p><p>14/1</p><p>4Fo</p><p>r pe</p><p>rson</p><p>al u</p><p>se o</p><p>nly.</p></li><li><p>criteria for JIA (19). We have included 22 patients withsJIA, 70 with oligoarticular JIA (both persistent andextended oligoarticular), and 26 with polyarticular JIA[both rheumatoid factor (RF) positive and RF negativepolyarticular]. The categories of psoriatic arthritis andenthesitis-related arthritis were not recruited. HLA-B27 iswell known to be highly associated with enthesitis-relatedJIA, and therefore all patients with positive HLA-B27 wereexcluded. Patient profiles are presented in Table 1. Werecruited 103 age- and sex-matched healthy controls fromthe National Taiwan University Hospital.DNA was extracted from whole blood of these subjects.</p><p>Serum was collected from 24 of the 96 oligoarticular/poly-articular JIA children at the time of disease remission (atclinical follow-up). Medical records were examined retro-spectively to obtain the initial clinical data with regard to C-reactive protein (CRP), erythrocyte sedimentation rate(ESR), age of onset, and the requirement of TNF-blocker(Enbrel) treatment. The study was approved by theInstitutional Ethical Committees. Informed consent wasobtained from parents or directly from individuals if theywere aged &gt; 15 years, according to the Declaration ofHelsinki (at the General Assembly in October 2008).</p><p>Genotyping</p><p>Genotyping was performed using genomic DNA isolatedfrom whole blood according to standard procedures, andfluorescence-labelled hybridization fluorescence resonanceenergy transfer (FRET) probes followed by melting curveanalysis as described previously (20, 21). Primers used forNLRP3/OR2B11 (rs4353135) forward and reverse wereGTTTCTTTTCAGAGCCTAAACTGG and TTGCTGAGATATTAAGGCAACATCA, respectively. Primers usedfor CARD8 (rs2043211) forward and reverse were AGCTACCCTGTGTTTCTGAGACC and ATTCATTCTCCCCTGAGTTCG, respectively. Probes for melting curveanalysis were: NLRP3/OR2B11 sensor: GCCGCATACATTTACCCCTC-FL, NLRP3/OR2B11 anchor: Red640-TCTTTCTTGCTTCC TTCATTCTCTCATTTCT, CARD8sensor: AGCACGG ATCA ATAATGGCTC-FL, CARD8anchor: Red640-C C TCTG TCTCATCATCTTCTTGGAAAAAATGT.The PCR reaction mixture included 2 L DNA (210</p><p>ng/L), 0.5 M of forward and reverse primers, and 0.2M of each fluorescence probe. PCR was performedon LightCycler1.5 (Roche Diagnostics, Mannheim,Germany). The PCR parameters for the rs4353135 and</p><p>rs2043211 polymorphisms were as follows: denaturationat 95C for 10 min, then 45 cycles of denaturation (95Cfor 15 s), annealing (62C for 10 s), and extension (72Cfor 10 s). Next, melting curve analysis was performed: 1cycle at 47C for 30 s, followed by an increase in tem-perature to 95C at a slope of 0.1C/s. Melting curveswere converted to melting peaks by plotting the secondnegative derivative of fluorescence with respect to tem-perature. A single peak at higher temperature represents ahomozygously mutated genotype (20, 21). A templatenegative control was included in each run. Duplicateverification was performed in 30 samples.</p><p>The genotype frequencies of the rs4353135 andrs2043211 polymorphisms in the controls showed nodeviation from HardyWeinberg equilibrium.</p><p>Enzyme-linked immunosorbent assay (ELISA)</p><p>Wemeasured serum levels of IL-1, the effector cytokine ofthe inflammasome pathway, in 24 genotyped oligoarticular/polyarticular JIA patients using a commercial human IL-1ELISA kit (R&amp;D Systems, Minneapolis, MN, USA).</p><p>Peripheral blood mononuclear cell (PBMC) stimulationassay</p><p>PBMCs (1 106) of different SNP genotypes were incu-batedwith completeRPMImediumonly or stimulatedwithphorbol 12-myristate 13-acetate (PMA) 100 ng/mL andionomycin 1 g/mL (both purchased from Sigma, StLouis, MO, USA) for 24 h. Brefeldin A 7.5 g/mL(Sigma) was added after 1 h of stimulation. Fluorescent-conjugatedmonoclonal antibodies against CD4 (BD, cloneRPA-T4), CD45RA (BioLegend, San Diego, CA, USA;clone HI30), and IL-17 (BD Biosciences, San Jose, CA,USA, clone N49-653) were used to stain intracellular pro-duction of IL-17 in CD4CD45RA cells. Cells weregated from the lymphocyte gate on a BD FACS Cantoflow cytometer, and were analysed using FACS Diva soft-ware version 6.0.</p><p>Statistical analysis</p><p>Fishers exact test was used to compare the percentage ofvariant allele carriers between JIA and healthy controls, andto compare allele frequencies between JIA with and withouthigh inflammation markers. The percentage of homozygous</p><p>Table 1. Clinical characteristics of JIA patients (n 118).Onset type</p><p>Oligoarticular Polyarticular Systemic Total</p><p>Female 31 14 13 58Male 39 12 9 60Age of onset (years), median (range) 11 (216) 8 (216) 7.5 (216) 10 (216)</p><p>Inflammasome SNPs and JIA 147</p><p>www.scandjrheumatol.dk</p><p>Scan</p><p>d J </p><p>Rhe</p><p>umat</p><p>ol D</p><p>ownl</p><p>oade</p><p>d fr</p><p>om in</p><p>form</p><p>ahea</p><p>lthca</p><p>re.c</p><p>om b</p><p>y Im</p><p>peri</p><p>al C</p><p>olle</p><p>ge L</p><p>ondo</p><p>n on</p><p> 06/</p><p>14/1</p><p>4Fo</p><p>r pe</p><p>rson</p><p>al u</p><p>se o</p><p>nly.</p></li><li><p>variant allele carriers in JIA treated with or without etaner-cept was also analysed by Fishers exact test. The serumlevels of IL-1 in JIA patients of different genotypes werecompared by using the KruskalWallis test. Delta meanfluorescent intensity (MFI) of IL-17 production in responseto PMA/ionomycin was compared between variant andnon-variant allele carriers by the MannWhitney U-test.</p><p>Results</p><p>The rs4353135 variant G allele carrier is associated withincreased risk for oligoarticular/polyarticular JIA</p><p>According to previous reports (7) and our review (22), theoligoarticular subtype shares molecular similarities withpolyarticular JIA. Therefore, we grouped these two sub-types together in this study. The percentage of rs4353135</p><p>variant G allele carrier was significantly higher in theoligoarticular/polyarticular group than in the healthy con-trols [odds ratio (OR) 2.127; 95% confidence interval (CI)1.004.54, p 0.036; Table 2]. However, there was only atrend of a higher percentage of rs2043211 variant allelecarrier in oligoarticular/polyarticular JIA patients (OR1.779, 95% CI 0.963.30, p 0.046; Table 2). The sJIAgroup showed no difference in percentages of both SNPcarriers compared with the controls (Table 2).</p><p>The rs4353135 variant G allele is associated withhigher clinical inflammatory parameters in oligoarticular/polyarticular JIA</p><p>We also investigated whether the NLRP3 and CARD8SNPs contributed to raised levels of CRP and ESR,</p><p>Table 2. Differences in genotype and allele frequencies of rs4353135 NLRP3 and rs2043211 CARD8 polymorphisms between healthycontrols and patients with juvenile idiopathic arthritis (JIA).</p><p>Genotype (%) Allele frequency</p><p>rs4353135 n T/T T/G G/G G (%) OR (95% CI) p-value*</p><p>Healthy controls 103 24 (23.3) 54 (52.4) 25 (24.3) 50.5Systemic JIA 22 2 (9.1) 15 (68.2) 5 (22.7) 56.8 2.582 (0.5611.99) 0.174Oligo-/polyarticular JIA 96 12 (12.5) 55 (57.3) 29 (30.2) 58.9 2.127 (1.004.54) 0.036</p><p>Genotype (%) Allele frequency</p><p>rs2043211 n T/T T/A A/A G (%) OR (95% CI) p-value*</p><p>Healthy controls 103 37 (35.9) 44 (42.7) 22 (21.4) 42.7Systemic JIA 22 9 (40.9) 10 (45.5) 3 (13.6) 36.4 0.810 (0.322.07) 0.417Oligo-/polyarticular JIA 96 23 (24.0) 59 (61.5) 14 (14.5) 45.3 1.779 (0.963.30) 0.046</p><p>OR, Odds ratio; CI, confidence interval.* Calculated by Fishers exact test comparing genotype frequencies of wild type vs. heterozygous homozygous variant allele carriers(rs4353135: T/T vs. T/GG/G; rs2043211: T/T vs. T/AA/A).</p><p>Table 3. Relationship between rs4353135 NLRP3 and rs2043211 CARD8 polymorphisms and CRP levels in patients with juvenileidiopathic arthritis (JIA).</p><p>Genotype (%)</p><p>rs4353135 n T/T T/G G/G G allele (%) OR (95% CI) p-value*</p><p>Systemic JIACRP 4 mg/dL 17 1 (5.9) 11 (64.7) 5 (29.4) 61.7 2.432 (0.5710.25) 0.195CRP &lt; 4 mg/dL 5 1 (20) 4 (80) 0 (0) 40</p><p>Oligo-/polyarticular JIACRP 4 mg/dL 10 1 (10) 1 (10) 8 (80) 85 4.486 (1.2715.88) 0.009CRP &lt; 4 mg/dL 86 11 (12.8) 54 (62.8) 21 (24.4) 55.8</p><p>Genotype (%)</p><p>rs2043211 n T/T T/A A/A A allele (%) OR (95% CI) p-value*</p><p>Systemic JIACRP 4 mg/dL 16 6 (37.5) 7 (43.7) 3 (18.8) 40.6 2.053 (0.469.07) 0.276CRP &lt; 4 mg/dL 6 3 (50) 3 (50) 0 (0) 25</p><p>Oligo-/polyarticular JIACRP 4 mg/dL 13 1 (10) 9 (10) 3 (80) 85 1.780 (0.774.11) 0.125CRP &lt; 4 mg/dL 83 22 (12.8) 50 (62.8) 11 (24.4) 55.8</p><p>OR, Odds ratio; CI, confidence interval; CRP, C-reactive protein.* Calculated by Fishers exact test comparing variant allele (G allele for rs4353135; A allele for rs2043211) frequencies between patientswith higher CRP ( 4mg/dL) and lower CRP levels.</p><p>148 C-A Yang et al</p><p>www.scandjrheumatol.dk</p><p>Scan</p><p>d J </p><p>Rhe</p><p>umat</p><p>ol D</p><p>ownl</p><p>oade</p><p>d fr</p><p>om in</p><p>form</p><p>ahea</p><p>lthca</p><p>re.c</p><p>om b</p><p>y Im</p><p>peri</p><p>al C</p><p>olle</p><p>ge L</p><p>ondo</p><p>n on</p><p> 06/</p><p>14/1</p><p>4Fo</p><p>r pe</p><p>rson</p><p>al u</p><p>se o</p><p>nly.</p></li><li><p>which are the most common clinical tests in evaluatinginflammation status of autoimmune diseases. Thers4353135 G allele frequency was found to be higher inoligoarticular/polyarticular JIA with elevated inflamma-tory markers at initial disease presentation (CRP 4 mg/dL vs. CRP &lt; 4 mg/dL, OR 4.486, 95% CI 1.2715.88,p 0.009, Table 3; ESR 20 mm/h vs. ESR &lt; 20 mm/h,OR 1.879, 95% CI 1.013.51, p 0.034, Table 4). Bycontrast, the rs2043211 variant A allele frequency wassimilar between oligoarticular/polyarticular JIA patientswith and without higher CRP/ESR. As for the sJIA group,no significant difference in NLRP3 and CARD8 SNPfrequencies was detected in patients with low and high</p><p>inflammatory markers. Of note, all sJIA patients had anincreased ESR level at the first clinical visit (Table 4).</p><p>The rs4353135 variant G allele is associatedwith enhancedIL-17 response in lymphocytes</p><p>As IL-1 is the effector cytokine of inflammasomes, weevaluated the level of IL-1 in serum of 24 out of 96oligoarticular/polyarticular JIA patients at the time of clin-ical follow-up (at disease remission; duration of disease andtreatment was between 1 and 2 years). However, the med-ian IL-1 level was zero in each rs4353135 genotypecarrier (KruskalWallis test p &gt; 0.05, Figure 1A).</p><p>Table 4. Relationship between rs4353135 NLRP3 and rs2043211 CARD8 polymorphisms and ESR levels in patients with juvenileidiopathic arthritis (JIA)</p><p>Genotype (%)</p><p>rs4353135 n T/T T/G G/G G allele (%) OR (95% CI) p-value*</p><p>Systemic JIAESR 20 mm/h 22 2 (9.1) 15 (68.2) 5 (22.7) 56.8 NA NAESR &lt; 20 mm/h 0 0 (0) 0 (0) 0 (0) 0</p><p>Oligo-/polyarticular JIAESR 20 mm/h 58 5 (8.6) 32 (55.2) 21 (36.2) 63.8 1.879 (1.013.51) 0.034ESR &lt; 20 mm/h 31 7 (22.6) 18 (58.1) 6 (19.3) 48.4</p><p>Genotype (%)</p><p>rs2043211 n T/T T/A A/A A allele (%) OR (95% CI) p-value*</p><p>Systemic JIAESR 20 mm/h 22 9 (9.1) 10 (68.2) 3 (22.7) 56.8 NA NAESR &lt; 20 mm/h 0 0 (0) 0 (0) 0 (0) 0</p><p>Oligo-/polyarticular JIAESR 20 mm/h 57 11 (19.3) 37 (64.9) 9 (15.8) 48.2 1.199...</p></li></ul>