H C G O

  • View
    34

  • Download
    0

Embed Size (px)

DESCRIPTION

Similitud de bandas en el ejemplo del cromosoma 1 de Humano (H), Chimpanc (C), Gorila (G) y Orangutn (O). H C G O. Etctera. - PowerPoint PPT Presentation

Transcript

  • H C G OEtcteraSimilitud de bandas en el ejemplo del cromosoma 1 de Humano (H), Chimpanc (C), Gorila (G) y Orangutn (O)

  • La similitud de bandas es reflejo de una homologa profunda, cuyo antecedente es la secuencia de bases nucleotdicas de la molcula de DNA del cromosoma. Por ejemplo, tomemos la banda 19q13.4 del cromosoma 19 de Homo sapiensEn el sector 19q13.42 se localiza la secuencia que codifica para la protena RFPL4A (ret finger protein-like 4), eventualmente involucrada en la regulacin de la gametognesis en los estados tempranos de la ontogenia)

  • Revise ahora en su gua la similitud de bandas de esta regin con la correspondiente en el cromosoma 19 de Pan troglodytes.Al analizar la homologa Homo-Pan a nivel de secuencias para el locus RFPL4A, encontramos que alcanza el 95%, confirmando el significado biolgico de la similitud observada a nivel de bandas

  • El % de identidad Homo vs Pan y las tasas de sustitucin no sinnimas respecto de las sustituciones sinnimas (dN/dS) corroboran el carcter homlogo del locus 19q13.42, recin analizado

  • Qu es lo ms notable aqu?Compare los patrones de bandas :6 cromosomas de humanos (Hu), son similares con las bandas de 7 cromosomas de tres especies de primates.

  • PARTES CROMOSOMICASTodos los Cromosomas tienen telmeros en sus extremos Telomero superiorCentrmero Telmero inferiorTelmeros tienen especiales secuencias de DNA ttagggttagggttagggttagggttagggttaggg||||||||||||||||||||||||||||||||||||aatcccaatcccaatcccaatcccaatcccaatccc

  • Enfoquemos dos cromosomas6 cromosomas de humanos (Hu), son similares a 7 cromosomas de tres especies de primates.

  • MAS PREGUNTASPorqu DOS cromosomas cortos de chimpanc hubo que aparearlos con nuestro cromosoma #2 ?Pudo nuestro cromosoma #2 haberse formado a partir de la FUSION de DOS cromosomas cortos que se encuentran en los chimpancs de hoy (#12 y #13)? Como sto?

  • Chimp #13Chimp #12Human #2

  • PREDICCIONSi la fusin ocurri, entonces deberamos encontrar secuencias de DNA telomricas precisamente en la regin central del cromosoma 2 humanoChimp #12Chimp #13Human #2Area deFUSION?

  • DNASequencia DNA Telomrica:ttagggttagggttaggg||||||||||||||||||aatcccaatcccaatccc TelmerosuperiorCentrmero TelmeroinferiorOBSERVE:Repeticiones en Tandem en Telmeros:ttagggttagggttaggg||||||||||||||||||aatcccaatcccaatcccRepetidos 800-1600 veces en cada Telmero

  • Qu espera Ud.?Qu espera observar? Repeticiones en tandem en el area de fusion

    Dnde las buscar?En la mitad de nuestro cromosoma #2

    Dnde encontrar estas secuencias?Buscndolas en alguna base de datos (GenBank)

    Qu puede decirse SI NO SE OBSERVAN?La fusion podra no haber ocurrido

  • RESULTADOS EN LA REGION108061 agcacagacc tgggggtcac cgtaaaggtg gagcagcatt cccctaagca cagaggttgg 108121 ggccactgcc tggctttgtg acaactcggg gcgcatcaac ggtgaataaa atctttcccg 108181 gttgcagccg tgaataatca aggttagaga ccagttagag cggttcagtg cggaaaacgg 108241 gaaagaaaaa gcccctctga atcctgggca gcgagattct cccaaagcaa ggcgaggggc 108301 tgcattgcag ggtgagggtg agggttaggg tttgggttgg gtttggggtt ggggttgggg 108361 taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt 108421 cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta 108481 agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt 108541 tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc 108601 aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc 108661 ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct 108721 accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta 108781 accctaacca taaccctaaa ccctaaccct aaaccctaac cctaaaccct aaccctaaca 108841 ctaccctacc ctaaccccaa cccctaaccc ctaaccctaa ccctacccct aaccccaacc 108901 ccagccccaa cccttaccct aaccctaccc taacccttaa ccctaacccc taaccctaac 108961 ccctaaccct aaccctaccc caaccccaaa cccaacccta acccaaccct aacccctaac 109021 cctaacccct accctaaccc ctagccctag ccctagccct aaccctaacc ctcgccctaa 109081 ccctcaccct aaccctcacc ctcaccctaa cccaacgtct gtgctgagaa gaatgctgct 109141 ccgcctttaa ggtgcccccc aggtctgtgc tgaacagaac gcagctccgc cgtcgcagtg 109201 ccctcagccc gcccgcccgg gtctgacctg agaagaactc tgctccgcct tcgcaatagc 109261 cccgaagtct gtgcagagga gaacgcagct ccgccctcgc gatgctctcc ggctgtgtgc 109321 taaagagaac gcaactccgc cctcgcaaag gcggcgcgcc ggcggaggcg cggagaggcg

  • RESULTADOS108061 agcacagacc tgggggtcac cgtaaaggtg gagcagcatt cccctaagca cagaggttgg 108121 ggccactgcc tggctttgtg acaactcggg gcgcatcaac ggtgaataaa atctttcccg 108181 gttgcagccg tgaataatca aggttagaga ccagttagag cggttcagtg cggaaaacgg 108241 gaaagaaaaa gcccctctga atcctgggca gcgagattct cccaaagcaa ggcgaggggc 108301 tgcattgcag ggtgagggtg agggttaggg tttgggttgg gtttggggtt ggggttgggg 108361 taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt 108421 cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta 108481 agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt 108541 tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc 108601 aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc 108661 ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct 108721 accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta 108781 accctaacca taaccctaaa ccctaaccct aaaccctaac cctaaaccct aaccctaaca 108841 ctaccctacc ctaaccccaa cccctaaccc ctaaccctaa ccctacccct aaccccaacc 108901 ccagccccaa cccttaccct aaccctaccc taacccttaa ccctaacccc taaccctaac 108961 ccctaaccct aaccctaccc caaccccaaa cccaacccta acccaaccct aacccctaac 109021 cctaacccct accctaaccc ctagccctag ccctagccct aaccctaacc ctcgccctaa 109081 ccctcaccct aaccctcacc ctcaccctaa cccaacgtct gtgctgagaa gaatgctgct 109141 ccgcctttaa ggtgcccccc aggtctgtgc tgaacagaac gcagctccgc cgtcgcagtg 109201 ccctcagccc gcccgcccgg gtctgacctg agaagaactc tgctccgcct tcgcaatagc 109261 cccgaagtct gtgcagagga gaacgcagct ccgccctcgc gatgctctcc ggctgtgtgc 109321 taaagagaac gcaactccgc cctcgcaaag gcggcgcgcc ggcggaggcg cggagaggcg SUPERIOR13SUPERIOR12OBSERVE dnde habra ocurrido la fusin de telmero 13 superior con superior 12?

Recommended

View more >