Hépatite C_ stratégie diagnostique et suivi virologique.ppt

  • Published on
    16-Jan-2015

  • View
    3.531

  • Download
    5

Embed Size (px)

DESCRIPTION

S. Chevaliez

Transcript

  • 1. HEPATITE C Stratgie Diagnostique & Suivi Virologique

2. Marqueurs Virologiques Stratgie diagnostique & suivi virologique Marqueurs indirects Anticorps anti-VHC totaux Marqueurs directs Ag de capside (AgC) ARN VHC Gnotype VHC Profil de rsistance 3. Tests Srologiques Stratgie diagnostique & suivi virologique

  • Dtection et quantification de lAg de capside
  • Test Combo
    • Dtection simultane de lAg de capside et des anticorps anti-VHC
  • Dtection des anticorps anti-VHC laide dune trousse de 3 megnration

4. Antigne de Capside : un Marqueur de la Rplication Bouvier-Alias et al.,Hepatology 2002, 36(1): 211-218. Stratgie diagnostique & suivi virologique r= 0.92; p < 0.0001 5.

  • Spcificit
    • 99,2% 100%
  • Sensitivit
    • 10 fmol/L (i.e~500 to 3 000 UI/mL dARN VHC)
    • Tous les gnotypes (except gnotype 2)
  • Intervalle de quantification
    • 10 20 000 fmol/L ( 7,8 Log 10UI/mL dARN VHC)
  • Stable 37C pendant 96 heures

Performances Analytiques de la Trousse Architect (Abbott) Ross et al.,J Clin Micribiol 2010, 48(4): 1161-8; Mederacke et al., J Clin Virol 2009, 46(3): 210-5; Miedouge et al., J Clin Virol 2010, 48(1):18-21. Stratgie diagnostique & suivi virologique 6. Trousse Architect : Monitoring des Cintiques Virales RVR(G1b) SVR(G1b) Relapser(G1b) NR(G1a) Ross et al.,J Clin Microbiol2010, 48(4): 1161-8. Stratgie diagnostique & suivi virologique Core Ag RNA 7. Intr ts Cliniques de la Quantification de lAgC

  • Diagnostic de linfection
    • Trousses commerciales
    • Facile utiliser, automatise, peu couteux (20% par rapport une charge virale VHC)
  • Dcision de traiter et suivi de lefficacit des traitements antiviraux
    • Quantitatif (20,000 fmol/L*)
    • Alternative aux techniques de dtection quantification de lARN du VHC

(*Abbott Architect HCV Ag Assay) Stratgie diagnostique & suivi virologique 8. Tests Virologiques Molculaires Stratgie diagnostique & suivi virologique Tests quantitatifs Seuil de dtection qualitatifs Quelle quantit est prsente ? Tests qualitatifs Trs sensibles ( 50 IU/mL) Est-ce que le VHC est prsent ? Dtermination du Gnotype Quel est le gnotype du virus ? Dtection de la rsistance Quel type de VHC est prsent ? 9. Tests Virologiques Molculaires Stratgie diagnostique & suivi virologique Est-ce que le VHC est prsent et en quelle quantit ? Tests Qualitatifs-Quantitatifs Dtermination du Gnotype Quel est le gnotype du virus ? Dtection de la rsistance Quel type de VHC est prsent ? 10. Intervalle de Quantification Stratgie diagnostique & suivi virologique 10 10 2 10 3 10 4 10 5 10 6 10 7 10 8 Cobas Amplicor HCV Monitor v2.0 SuperQuant LCx HCV RNA Assay Versant HCV RNA 3.0 (bDNA) 11. Avantages Techniques de la PCR en Temps Rel

  • Diminution du risque de contamination
  • Amlioration de la sensibilit
  • Augmentation de lintervalle de quantification linaire
  • Amlioration prcision et reproductibilit
  • Augmentation de dbit travers lautomatisation

Stratgie diagnostique & suivi virologique 12. Intervalle de Quantification Stratgie diagnostique & suivi virologique 10 10 2 10 3 10 4 10 5 10 6 10 7 10 8 *in development TaqMan 48 HCV (Roche) HCV Quant ASR (Abbott) Artus HCV QS-RGQ (Qiagen)* Versant HCV RNA 1.0 (kPCR, Siemens)* Cobas Amplicor HCV Monitor v2.0 SuperQuant LCx HCV RNA Assay Versant HCV RNA 3.0 (bDNA) 13. Plates-formes CAP-CTM96 (ROCHE) kPCR (SIEMENS) m 2000 SP - m 2000 RT(ABBOTT) Stratgie diagnostique & suivi virologique 14.

  • Remplace les techniques qualitatives de dtection de lARN VHC
  • Quantifie lensemble des charges virales observes en pratique clinique
    • Charges leves prthrapeutiques
    • Faibles charges virales au cours du traitement
  • Surveille efficacement les cintiques virales (valuation prcoce des rponses virologiques au traitement)

Avantages Cliniques de la PCR en Temps Rel Stratgie diagnostique & suivi virologique 15. Stratgie diagnostique & suivi virologique Quantification ARN du VHC (CTM, Roche) Chevaliez et al., 2007; Hepatology, 46(1): 22-31. HCV RNA level in Versant HCV 3.0 Assay bDNA (Log 10IU/mL)r= 0.889; p < 0.0001 HCV RNA level in CAP/CTM48 (Log 10IU/mL) Genotype 1 (n=29) Genotype 2 (n=27) Genotype 3 (n=29)Genotype 4 (n=30) Genotype 5 (n=9) Genotype 6 (n=2) 8 7 6 5 4 3 8 7 6 5 4 3 16. 8090100110120130140150160170180 |.........|.........|.........|.........|.........|.........|.........|.........|.........|.........| F_7157(4a): TAGCCATGGCGTTAGTATGAGTGTTGT G CAGCCTCCAGGACCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTGAGT A CACCGGAATCGCCGG Patient 1 (4h): ...........................A.....................................A...................T............... Patient 2 (4l): ...........................A.....................................A...................T............... 190200210220230240250260270.........|.........|...... - ...|.........| .........|.........|.........|.........| .........|........ F_7157(4a): GATGACCGGGTCCTTTCTTGGA T T A A - CCCGCTCAATGCCCGGAAATTTGGGCGTGCCCCCGCAAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCC Patient 1 (4h): ......................A.T.A.......................................................................... Patient 2 (4l): .......................C..-.......................................................C.......T.......... 280290300310320330340 |.........|.........|.........|.........|.........|.........|. F_7157(4a): TTGTGGTACTGCCTGATAGGGTGCTTGCGAGTGCCCCGGGAGGTCTCGTAGACCGTGCACC Patient 1 (4h):............................................................. Patient 2 (4l):............................................................. Chevaliez et al., 2008; Hepatology, 49(4): 1397-1398. Stratgie diagnostique & suivi virologique Absence de Dtection de lARN Viral de patients Fortement Virmiques Infects par un Gnotype 4 (Log 10IU/mL) CAP/CTM96 m 2000 SP / m 2000 RTVersant 3.0 Patient 1 (4h)