Molekulargenetische Diagnostik Segregationsanalysen (indirekte Diagnostik) monogene Erkrankung (Retinoblastom) genetisch heterogene Erkrankung (multiple.

  • Published on
    06-Apr-2016

  • View
    215

  • Download
    1

Transcript

  • Molekulargenetische Diagnostik Segregationsanalysen (indirekte Diagnostik) monogene Erkrankung (Retinoblastom) genetisch heterogene Erkrankung (multiple kartilaginre Exostosen)

    DNA-Sequenzanalyse (direkte Diagnostik) (Tricho-Rhino-Phalangeales Syndrom)

    MLPA (direkte Diagnostik, Retinoblastom) (D. Lohmann) H.-J. Ldecke

  • Retinoblastom

  • Familienanamnese bei RetinoblastomFamilie L.S.Familie J.W.Familie L.B.

  • Erbliches Retinoblastomrb rbRB rbrb X RBTumorkonstitutionellKeimbahnrbRBGametenersteMutationzweiteMutation

  • Retinoblastomgen1236717182753Genomische DNAExonIntronIntronBeispiele fr Mutationen in kodierenden Bereichen

  • Segregation

  • Indirekte Diagnostik: Segregation gekoppelter Marker

  • VNTR-Polymorphismus 14801 ggtgtacgtc tatacagggc tatgtataac cgactcctgt ttctcctccc 14851 tgcaaccaca gaaccatcac acacacacac acacacacac acacacacac

    14901 acacacacac acacggatac acgcacagat acgctccttt ccacaaatgc

    14951 acgcaaaccg ggacgcaaac ccacaactcg agggcttaga ccttcactgc 53

  • Intragene VNTR-Loci... CTTT ... ... GAAA ...53D13S153(RBi2)RB1.20... CA ... ... GT ...nnVNTR-Loci

  • GenotypisierungRB1, vterliches AllelRB1, mtterliches Allel

  • KopplungsphaseRB1, mutiert4bpDeletionExon 4

  • Kopplungsphase14-2014-1815-1818-2014-16Rb1.20- Genotyp

  • Kopplungsphase14-2014-1815-1818-2014-16Rb1.20- Genotyp4bpDeletionExon 4

  • Analyse von VNTR-Loci53PCRFragmentlngenanalyse durch elektrophoretische Auftrennung oder

  • Gelektrophorese

  • Agarosegel in ElektrophresekammerKathode (+)Anode ()

  • Auftragen der Proben

  • Elektrophoretische Auftrennung

  • Dokumentation per Videobild

  • Dokumentation

  • Genotypisierung1-51-42-44-51-3Rb1.20- GenotypI-1I-2II-2II-3III-1

  • Familie I1111

  • Familie I2222221-21222

  • Familie I31-212-32-32-333333333

  • Familie I41-21-42-32-32-33-4334

  • Familie I1-21-42-32-32-33-43-53-555

  • Familie I1-21-42-32-32-33-43-53-5

  • Familie 22-31-31-32-3

  • Familie 34-52-42-41-53-41-54-41-43

  • Familie 42-42-42-32-32-43-41-34

  • Prdiktive Diagnostik bei LocusheterogenittSegregationsanalyse bei hereditren multiplen cartilaginren Exostosen (HME)Hermann-Josef Ldecke

  • Lokalisierung der Exostosen

  • Multiple cartilaginre Exostosen Hufigkeit1 : 50.000 Penetranz 100 % autosomal dominant genetisch heterogen 8q24.1EXT1 11p11-12EXT2 (19pEXT3)

  • Spektrum der Mutationen in EXT1 und EXT2Wuyts & van Hul, 2000

  • Kopplungsanalyseund Segregationsanalysemit EXT1- bzw. EXT2- intragenen Mikrosatelliten-Markern

  • genomische Organisation des EXT1-Gens

  • Kopplungsphase:Risiko:PPPGPPPEXT2, Allel 2MPkein Risiko

  • bungsaufgaben

  • PPEXT1, Allel 2Pkein Risiko fr III2

  • PPPPkeine Aussage mglich

  • PPEXT2, Allel 2PIndividuum III2 wird erkranken

  • PPPMMMMMP?P ?Fehlen paternaler EXT1-Allele

  • der(8)der(5)8der(5)55Sonde: "paint 5"Sonde: y960B10

  • Molekulargenetische Diagnostik durch DNA-Sequenzanalyse

  • PunktmutationenTHE CAT DID EAT THE RED HATTHE RAT DID EAT THE RED HATTHE ATD IDE ATT HER EDH ATTHE CHA TDI DEA TTH ERE DHA T

  • 1. Enzymatische Vermehrung des zu untersuchenden Genabschnittes mittels PCRCave: Es werden immer das maternale und paternale gemeinsam amplifiziert!

  • 2. Enzymatische Sequenzierung nach SangerTemplate (Matrize)3'-TTCAGTAACGATGCATTGACTGTACTAGGAGCGCGTAC-5'Primer (Startmolekl)5'-AAGTCATTGC-3'3'-TTCAGTAACGATGCATTGACTGTACTAGGAGCGCGTAC-5'5'-AAGTCATTGC-3'Primer-Annealing (Anlagerung)DNA-PolymerasedNTPsddATP, ddGTP, ddCTP, ddTTPPrimer-Verlngerung und Kettenabbruch

  • Enzymatische Sequenzierung nach SangerTemplate (Matrize, einzelstrngig)3'-TTCAGTAACGATGCATTGACTGTACTAGGAGCGCGTAC-5'Primer (Startmolekl)5'-AAGTCATTGC-3'3'-TTCAGTAACGATGCATTGACTGTACTAGGAGCGCGTAC-5'5'-AAGTCATTGC-3'3'-TTCAGTAACGATGCATTGACTGTACTAGGAGCGCGTAC-5'5'-AAGTCATTGC3'-TTCAGTAACGATGCATTGACTGTACTAGGAGCGCGTAC-5'5'-AAGTCATTGC3'-TTCAGTAACGATGCATTGACTGTACTAGGAGCGCGTAC-5'5'-AAGTCATTGCPrimer-Annealing (Anlagerung)DNA-PolymerasedNTPsddATP, ddGTP, ddCTP, ddTTPPrimer-Verlngerung und Kettenabbruch TACGTAACTTACGTAACTGTACGTAACTGA3'-TTCAGTAACGATGCATTGACTGTACTAGGAGCGCGTAC-5'5'-AAGTCATTGCTACGTAACTGAC

  • Enzymatische Sequenzierung nach Sanger3'-TTCAGTAACGATGCATTGACTGTACTAGGAGCGCGTAC-5'5'-AAGTCATTGC-3'5'-AAGTCATTGCTACGTDNA-PolymerasedNTPsddATP, ddGTP, ddCTP, ddTTPPrimer-Verlngerung und Kettenabbruch 5'-AAGTCATTGCTACGTAA5'-AAGTCATTGCTACGTAAChier sind einmal alle Produkte der Primer-Verlngerung gezeigt:5'-AAGTCATTGCT5'-AAGTCATTGCTA5'-AAGTCATTGCTAC5'-AAGTCATTGCTACG5'-AAGTCATTGCTACGTA5'-AAGTCATTGCTACGTAACT5'-AAGTCATTGCTACGTAACTG5'-AAGTCATTGCTACGTAACTGAusw.

  • GelelektrophoreseKapillarelektrophorese

  • manuelle Beladung der Geleautomatische Beladung der Kapillaren

  • PatientNormalpersonCGATGA

  • Klinische Zeichen:

    dnnes, sprliches Kopfhaar groe, "birnenfrmige" Nase langes, flaches Philtrum schmales Oberlippenrot Zapfenepiphysen Brachydaktylie Hftvernderungen Kleinwuchs multiple cartilaginre Exostosen (nur TRPS II)Tricho-Rhino-Phalangeale SyndromeTRPS1EXT1

  • Tricho-Rhino-Phalangeales SyndromAn dieser Stelle wurde im Praktikum das Foto einer Patientin gezeigt. Dieses darf jedoch nicht im Internet verffentlicht werden. Ich hoffe, Sie haben sich die Charakteristika des TRPS einprgen knnen.

  • Struktur des TRPS1 Transkriptionsfaktors

  • Sequenzierung von Exon 6 des TRPS1-GensCGA CAA; Arg Gln; R Q

  • bungsaufgaben

  • Patient 1NormalpersonCCGGTGTTTTTTGTGCCAATTGCCTGACCACAAAGACCTCTC

  • Patient 1NormalpersonCCGGTGTTTTTTGTGCCAATTGCCTGACCACAAAGACCTCTC

  • Struktur des Zinkfingers vom "GATA"-Typ

  • aus: Vilain et al. (1999) Am J Med Genet 85:495-497

  • Patient 2Normalperson

  • Patient 2NormalpersonWildtyp:mutant:T-Insertion

  • Patient 3Normalperson= Stop

  • Patient 4Normalperson

  • RNA - Spleissen

  • Multiplex Ligation-dependent Probe Amplication (MLPA)

  • SALSA MLPA probes

  • HybridisierungDer MLPA Sondenmix wird zu denaturierter genomischer DNA gegebenDie zwei Teile jeder Sonde hybridisieren mit benachbarten ZielsequenzenBeachte den Unterschied

  • Ligation3. Die Sonden werden mit Hilfe einer thermostabilen Ligase verbunden (ligiert)

  • AmplificationMit einem universellen Primerpaar kann man alle ligierten Sonden amplifizierenDas Amplifikationsprodukt jeder einzelnen Sonde hat eine genau definierte Lnge (92 - 481 bp).Fluoreszenzfarbstoff

Recommended

View more >