Molekulargenetische Diagnostik  Segregationsanalysen (indirekte Diagnostik)  monogene Erkrankung (Retinoblastom)  genetisch heterogene Erkrankung (multiple.

  • Published on
    06-Apr-2016

  • View
    215

  • Download
    1

Transcript

Molekulargenetische Diagnostik Segregationsanalysen (indirekte Diagnostik) monogene Erkrankung (Retinoblastom) genetisch heterogene Erkrankung (multiple kartilaginre Exostosen) DNA-Sequenzanalyse (direkte Diagnostik) (Tricho-Rhino-Phalangeales Syndrom) MLPA (direkte Diagnostik, Retinoblastom) (D. Lohmann) H.-J. LdeckeRetinoblastomFamilienanamnese bei RetinoblastomFamilie L.S.Familie J.W.Familie L.B.Erbliches Retinoblastomrb rbRB rbrb X RBTumorkonstitutionellKeimbahnrbRBGametenersteMutationzweiteMutationRetinoblastomgen1236717182753Genomische DNAExonIntronIntronBeispiele fr Mutationen in kodierenden BereichenSegregationIndirekte Diagnostik: Segregation gekoppelter MarkerVNTR-Polymorphismus 14801 ggtgtacgtc tatacagggc tatgtataac cgactcctgt ttctcctccc 14851 tgcaaccaca gaaccatcac acacacacac acacacacac acacacacac 14901 acacacacac acacggatac acgcacagat acgctccttt ccacaaatgc 14951 acgcaaaccg ggacgcaaac ccacaactcg agggcttaga ccttcactgc 53Intragene VNTR-Loci... CTTT ... ... GAAA ...53D13S153(RBi2)RB1.20... CA ... ... GT ...nnVNTR-LociGenotypisierungRB1, vterliches AllelRB1, mtterliches AllelKopplungsphaseRB1, mutiert4bpDeletionExon 4Kopplungsphase14-2014-1815-1818-2014-16Rb1.20- GenotypKopplungsphase14-2014-1815-1818-2014-16Rb1.20- Genotyp4bpDeletionExon 4Analyse von VNTR-Loci53PCRFragmentlngenanalyse durch elektrophoretische Auftrennung oderGelektrophoreseAgarosegel in ElektrophresekammerKathode (+)Anode ()Auftragen der ProbenElektrophoretische AuftrennungDokumentation per VideobildDokumentationGenotypisierung1-51-42-44-51-3Rb1.20- GenotypI-1I-2II-2II-3III-1Familie I1111Familie I2222221-21222Familie I31-212-32-32-333333333Familie I41-21-42-32-32-33-4334Familie I1-21-42-32-32-33-43-53-555Familie I1-21-42-32-32-33-43-53-5Familie 22-31-31-32-3Familie 34-52-42-41-53-41-54-41-43Familie 42-42-42-32-32-43-41-34Prdiktive Diagnostik bei LocusheterogenittSegregationsanalyse bei hereditren multiplen cartilaginren Exostosen (HME)Hermann-Josef LdeckeLokalisierung der ExostosenMultiple cartilaginre Exostosen Hufigkeit1 : 50.000 Penetranz 100 % autosomal dominant genetisch heterogen 8q24.1EXT1 11p11-12EXT2 (19pEXT3)Spektrum der Mutationen in EXT1 und EXT2Wuyts & van Hul, 2000Kopplungsanalyseund Segregationsanalysemit EXT1- bzw. EXT2- intragenen Mikrosatelliten-Markerngenomische Organisation des EXT1-GensKopplungsphase:Risiko:PPPGPPPEXT2, Allel 2MPkein RisikobungsaufgabenPPEXT1, Allel 2Pkein Risiko fr III2PPPPkeine Aussage mglichPPEXT2, Allel 2PIndividuum III2 wird erkrankenPPPMMMMMP?P ?Fehlen paternaler EXT1-Alleleder(8)der(5)8der(5)55Sonde: "paint 5"Sonde: y960B10Molekulargenetische Diagnostik durch DNA-SequenzanalysePunktmutationenTHE CAT DID EAT THE RED HATTHE RAT DID EAT THE RED HATTHE ATD IDE ATT HER EDH ATTHE CHA TDI DEA TTH ERE DHA T1. Enzymatische Vermehrung des zu untersuchenden Genabschnittes mittels PCRCave: Es werden immer das maternale und paternale gemeinsam amplifiziert!2. Enzymatische Sequenzierung nach SangerTemplate (Matrize)3'-TTCAGTAACGATGCATTGACTGTACTAGGAGCGCGTAC-5'Primer (Startmolekl)5'-AAGTCATTGC-3'3'-TTCAGTAACGATGCATTGACTGTACTAGGAGCGCGTAC-5'5'-AAGTCATTGC-3'Primer-Annealing (Anlagerung)DNA-PolymerasedNTPsddATP, ddGTP, ddCTP, ddTTPPrimer-Verlngerung und Kettenabbruch Enzymatische Sequenzierung nach SangerTemplate (Matrize, einzelstrngig)3'-TTCAGTAACGATGCATTGACTGTACTAGGAGCGCGTAC-5'Primer (Startmolekl)5'-AAGTCATTGC-3'3'-TTCAGTAACGATGCATTGACTGTACTAGGAGCGCGTAC-5'5'-AAGTCATTGC-3'3'-TTCAGTAACGATGCATTGACTGTACTAGGAGCGCGTAC-5'5'-AAGTCATTGC3'-TTCAGTAACGATGCATTGACTGTACTAGGAGCGCGTAC-5'5'-AAGTCATTGC3'-TTCAGTAACGATGCATTGACTGTACTAGGAGCGCGTAC-5'5'-AAGTCATTGCPrimer-Annealing (Anlagerung)DNA-PolymerasedNTPsddATP, ddGTP, ddCTP, ddTTPPrimer-Verlngerung und Kettenabbruch TACGTAACTTACGTAACTGTACGTAACTGA3'-TTCAGTAACGATGCATTGACTGTACTAGGAGCGCGTAC-5'5'-AAGTCATTGCTACGTAACTGACEnzymatische Sequenzierung nach Sanger3'-TTCAGTAACGATGCATTGACTGTACTAGGAGCGCGTAC-5'5'-AAGTCATTGC-3'5'-AAGTCATTGCTACGTDNA-PolymerasedNTPsddATP, ddGTP, ddCTP, ddTTPPrimer-Verlngerung und Kettenabbruch 5'-AAGTCATTGCTACGTAA5'-AAGTCATTGCTACGTAAChier sind einmal alle Produkte der Primer-Verlngerung gezeigt:5'-AAGTCATTGCT5'-AAGTCATTGCTA5'-AAGTCATTGCTAC5'-AAGTCATTGCTACG5'-AAGTCATTGCTACGTA5'-AAGTCATTGCTACGTAACT5'-AAGTCATTGCTACGTAACTG5'-AAGTCATTGCTACGTAACTGAusw.GelelektrophoreseKapillarelektrophoresemanuelle Beladung der Geleautomatische Beladung der KapillarenPatientNormalpersonCGATGAKlinische Zeichen: dnnes, sprliches Kopfhaar groe, "birnenfrmige" Nase langes, flaches Philtrum schmales Oberlippenrot Zapfenepiphysen Brachydaktylie Hftvernderungen Kleinwuchs multiple cartilaginre Exostosen (nur TRPS II)Tricho-Rhino-Phalangeale SyndromeTRPS1EXT1Tricho-Rhino-Phalangeales SyndromAn dieser Stelle wurde im Praktikum das Foto einer Patientin gezeigt. Dieses darf jedoch nicht im Internet verffentlicht werden. Ich hoffe, Sie haben sich die Charakteristika des TRPS einprgen knnen.Struktur des TRPS1 TranskriptionsfaktorsSequenzierung von Exon 6 des TRPS1-GensCGA CAA; Arg Gln; R QbungsaufgabenPatient 1NormalpersonCCGGTGTTTTTTGTGCCAATTGCCTGACCACAAAGACCTCTCPatient 1NormalpersonCCGGTGTTTTTTGTGCCAATTGCCTGACCACAAAGACCTCTCStruktur des Zinkfingers vom "GATA"-Typaus: Vilain et al. (1999) Am J Med Genet 85:495-497Patient 2NormalpersonPatient 2NormalpersonWildtyp:mutant:T-InsertionPatient 3Normalperson= StopPatient 4NormalpersonRNA - SpleissenMultiplex Ligation-dependent Probe Amplication (MLPA)SALSA MLPA probesHybridisierungDer MLPA Sondenmix wird zu denaturierter genomischer DNA gegebenDie zwei Teile jeder Sonde hybridisieren mit benachbarten ZielsequenzenBeachte den UnterschiedLigation3. Die Sonden werden mit Hilfe einer thermostabilen Ligase verbunden (ligiert)AmplificationMit einem universellen Primerpaar kann man alle ligierten Sonden amplifizierenDas Amplifikationsprodukt jeder einzelnen Sonde hat eine genau definierte Lnge (92 - 481 bp).Fluoreszenzfarbstoff

Recommended

View more >