PCR Troubleshooting Virginia Balke Delaware Technical Community College CCURI Lab Methods Workshop Tulsa Community College July 2015.

  • Published on
    01-Jan-2016

  • View
    213

  • Download
    0

Embed Size (px)

Transcript

PCR Troubleshooting

PCR TroubleshootingVirginia BalkeDelaware Technical Community CollegeCCURI Lab Methods WorkshopTulsa Community CollegeJuly 2015Day 1Thursday, July 9Reaction ComponentsTemplate Target DNATaq PolymeraseBuffer (2x, 5x, 10x)Magnesium chloridedNTPsPrimers Forward and Reverse0.1 to 0.5 MTemplateQuantity and Quality

Quantity depends on typePlasmid 1 pg to 1 ngGenomic 1 ng to 1 g

Quality depends on sourceAvoid freeze/thawKeep on ice4Taq PolymerasesStandardNo 3 5 exonuclease proofreading3 A for Topo TA cloning1/1,000 to 1/10,000 error rate

Hot StartModifications that inhibit activity until heatingAntibodies, covalent modifications, aptamersTaq PolymerasesHigh Fidelity3 5 exonuclease proofreadingBlunt ends1/100,000 to 1/1,000,000 error rate

Rapid CyclingSteps are shortened to 5 to 10 seconds

Magnesium ChlorideCofactor for enzymesStabilizes DNA and dNTPsIncreasing MgCl2, increases Tm

Most PCR Master Mixes contain 1.5 mM MgCl2Can be optimizedDifferent Types of KitsEach component is separate 2x or 10x Master Mixes

Components to increase specificityLoading dyeDesigning Cycling ConditionsInitial denaturation 95C for 2 5 minutesDenaturation 95C for 30 secondsAnnealing2 5 degrees below lowest primer Tm30 60 secondsExtension72CTime depends on length of amplicon1 kb for 1 minute

Repeat 30 35 cyclesFinal extension at 72C for 5 15 minutesHold 4 12C

Calculating Primer Tm2C x (A + T) + 4C x (G + C)Day 2Friday July 10DNA Barcodes for Everyday LifeReaction mixtureMgCl2 concentration?

Use of multiple primers

Percentage of NSBarcoding at DTCCMicrobiology16S rRNA on cultured soil microbesMaster Mix is prepared by instructor

BiotechnologyCulture independent analysis of soil microbesInsects as part of bat diet projectStudents increasingly learn to do calculations and make own master mixBarcoding at DTCCResearch ProjectsFern SpeciesBig Brown Bat diet (primer specificity issues)Species confirmation of batsMouse ID

Mammal BarcodingTemplate is mouse genomic DNACOX primersForward TCAACCAACCACAAAGACATTGGCAC Tm = 65Reverse TAGACTTCTGGGTGGCCAAAGAATCA Tm = 65

Amplicon size 650 bpOptimizing Reaction ConditionsTemplate ConcentrationPrimer ConcentrationMgCl2 Concentration

Temperature Gradient

Negative and Positive ControlPCR SetupThree different Taq formulationsQiagen HotStarTaq Master MixQiagen TopTaq Master MixQiagen TopTaq Polymerase

Three different MgCl2 concentrationsThree different temperatures20 L reactions, 2 L template1 L primer mixCalculating MgCl2Master Mixes and Buffers contain 1.5 mM MgCl2

To bring to 2.5 mM add 1 mM MgCl2

To bring to 4 mM add 2.5 mM MgCl2Cycling Conditions95C 5 minutes35x95C for 1 min 43, 52, or 58C 30 sec 72C 30sec 72C 15 minutes12C Hold

Primer Design18 30 bases in length40 60% GC contentAim for Tm of 55 to 70CTm of pair should be similarHave C or A at 3 terminal (they do not wobble)Avoid runs of 3 or more of the same baseAvoid complementarity between the two primersAvoid hairpins internallyAvoid self-complementarityPrimer DesignDesign primers for a gene from Sphingobacterium sp. ML3W

Use IDT to analyze primershttp://www.idtdna.com/calc/analyzer

Primer DesignAs much as possible make sure that your primer pair does not bind elsewhere in the genomeUse BLAST http://blast.ncbi.nlm.nih.gov/Blast.cgi to check if your primers bind to a unique site in the Sphingobacterium sp. ML3W genomeBLAST nucleotideAlign two or more sequencesPaste your primers into the first boxPaste the ML3W Accession number: CP009278.1 into the second box

Recommended

View more >