Novas tecnologias sequenciamento fronteiras biologia unb 10112010

  • Published on
    20-Jun-2015

  • View
    2.111

  • Download
    1

Embed Size (px)

DESCRIPTION

Palestra proferida pelo Prof. Rinaldo Pereira no dia 10/11/2010 como parte da Semana de Biologia da UnB

Transcript

<ul><li> 1. Novas tecnologias de Sequenciamento de DNA como ferramentas para o avano em novas fronteiras da biologia Foco em Gentica Humana Prof. Dr. Rinaldo Wellerson Pereira Bolsista Produtividade CNPq 2 Universidade Catlica de Braslia Orientador Permanente: Cincias Genmicas e Biotecnologia, UCB Educao Fsica, UCB Orientador Credenciado: Patologia Molecular, UNB </li></ul> <p> 2. De Mendel a era omica Aa A a 3 3 A T G C A T T A G T A C G T A A T C A T G C C T T A G T A C G G A A T C 5 5 5 5 3 3 A U G C A U U A G A U G C C U U A G 5 3 5 3 Met His Stop Met Pro Stop A a Mendel Cromossomos Dupla Hlice Sequncia de nucleotdeos mRNA Protena 3. Sequenciamento de DNA .................................acctagagaaga cacatcagctgatcctttggaccctct gacttgagacagaagttctgggcttct cctcctgcggcctagctctgagacaat gaacgctacacactgcatcttggcttt gcagctcttcctcatggctgtttctgg ctgttactgccacggcacagtcattga aagcctagaaagtctgaataactattt taactcaagtggcatagatgtggaaga aaagagtctcttcttggatatctggag gaactggcaaaaggatggtgacatgaa aatcctgcagagccagattatctcttt ctacct.............. 4. Sequenciamento de DNA Mtodo de Sanger 5. Sequenciamento de DNA Mtodo de Sanger - Automatizao 96 poos 384 poos 6. Sequenciamento de DNA Deteco Simultnea de Quatro Cores 7. Sequenciamento de DNA 1977 -2004 Evoluo e consolidao do mtodo de Sanger 2004 - . Plataformas de NGS Next Generation Sequencing (Na verdade pode ser: Now Generation Sequencing) Segunda Gerao Terceira Gerao 8. Shendure, 2008 Nature Biotechnology 9. Venter, 2010 - Nature 10. Venter, 2010 - Nature 11. As plataformas 12. 454 Roche 13. 454 Roche 14. Futuro novas tecnologias para seqenciamento de DNA 15. 454 Roche http://www.454.com/flash/roche-gene.asp 16. Genome Analyser - Illumina 17. Genome Analyser - Illumina 18. Genome Analyser - Illumina 19. Solid Systems Life Technologies 20. Helicos - Helicospe 21. Pacific Bioscience SMRT 22. Nature Reviews Genetics, 31-45, 2010 23. Custos 24. DNA mRNA Protenas Variao Normal ou Patolgica Dogma Central 25. Cromatina mRNA ncRNA Protenas Variao Normal ou PatolgicaAmbiente Variao em seqncia Variao estrutural Variao qumica na cromatina Epigenmica Genmica Transcritmica Protemica Dogma Central 26. Sequenciando Genomas para Investigar Variabilidade SNVs Single nucleotide variants SNPs Single nucleotide polymorphisms CNVs Copy number variants CNPs Copy number polymorphisms 27. Genomas Individuais http://huref.jcvi.org/ Sequenciado pelo mtodo de Sanger 28. http://jimwatsonsequence.cshl.edu/cgi-perl/gbrowse/jwsequence/ Sequenciado com 454 29. Genomas Individuais Bentley et al. Wang et al. http://yh.genomics.org.cn/ http://www.illumina.com/HumanGenome/ 30. Exploso de Genomas Individuais 2001 2004 2007 2008 2009 2010 31. Mais e mais Genomas Individuais 32. Antropologia Molecular 33. Sequenciamento de Genomas como mtodo de diagnstico Exoma Genoma Total 34. Exoma 35. Targeted Resequencing 36. Missing Heritability e o sequenciamento de genomas individuais 37. Next Generation Sequencing amplia possibilidades de melhor caracterizao da variao estrutural em genomas 38. Transcritoma - RNAseq Splicing Alternativo ncRNA 39. Splicing Alternativo 95% de sequncias codificantes multiexnicas apresentam splicing altertivo Estima-se que em mdia, cada sequncias codificantes multiexnicas tenha 7 isoformas H variao interpopulacional e interindividual no repertrio de isoformas em diferentes tipos celulares No comeo do comeo do entendimento de como estas variaes contribuem para a variabilidade normal e patolgica NGS tem clara vantagem sobre microarranjos baseados em transcritos conhecidos 40. RNAs no codificantes 90% do genoma humano transcrito Small ncRNA Long ncRNA 41. Epigenmica Metilao em DNA Sequenciamento de DNA tratado com bisulfito 42. Epigenmica Mapeando DNA associado modificaes em histonas (CHIP) 43. CHIP e NGS 44. Modificaes em Histonas 45. Genoma mRNA ncRNA Protenas Variao Normal ou PatolgicaAmbiente Variao em seqncia Variao estrutural Variao qumica na cromatina Epigenmica Genmica Transcritmica Protemica 46. Onde estamos na UCB Genmica DF 454 Titanium Illumina GAIIx Projetos RNAseq em Leucemia linfide aguda (FAP-DF) RNAseq, Metiloma e ChipSeq em projeto de investigao de mecanismos moleculares envolvidos na adaptao molecular ao exerccio aerbio (Pronex FAP-DF) Projeto Edital Pr-Centro Oeste Sequenciamento de exons em pacientes com retardo mental, displasias esquelticas e mal formaes cardacas 47. Polcia Civil do DF O Centro de Genmica como uma estratgia e desafio ao fomento da inovao no Distrito Federal. 48. Sala principal dos sequenciadores 49. Sala de preparo de bibliotecas Sala de apoio 50. Programa de Ps Graduao em Cincias Genmicas e Biotecnologia SGAN 916 Mdulo B Bloco C http://www.ucb.br/posgraduacao/biotecnologia/bio.htm 51. Contatos @rinaldowp (Cincia e Corridas ) rinaldo.pereira (Cincia e Corridas) rinaldo.pereira@catolica.edu.br </p>

Recommended

View more >