Методология безопасного применения лекарств у беременных

  • Published on
    16-Jun-2015

  • View
    456

  • Download
    1

Embed Size (px)

DESCRIPTION

. 20 2013 . -"

Transcript

<ul><li> 1. 20 2013 . . . .., </li></ul> <p> 2. 3. : , . ( ) Lupattelli A, Spigset O, Twigg MJ, Zagorodnikova K et al BMJ Open. 2014 Feb 17;4(2):e004365. 4. Lupattelli A, Spigset O, Twigg MJ, Zagorodnikova K et al BMJ Open. 2014 Feb 17;4(2):e004365. 5. , 6. , % .. . 7. , .. . 8. .. . 9. ? 10. ( ) ( ) 11. 1960 12. 1963 (16.36) 1968 1971 13. (-) 1998 . () (, ) () 14. D 15. ! !!! ! 16. () , , , , , () !!! . 17. ? : : 18. ; ; /; ; (Shepard, Ronald) 19. ! , 20. 69,4% - (Nordeng H et al 2010, EJCP) 87% (Bonari L.et al. 2005) (Baggley et al 2004; Koren, 1990) 21. CYP1A2 ( , ) (Tsutsumi et al) CYP2A6 ( , ) (Dempsey et al 02) CYP2C9 ( , ) (Tomson et al 94) CYP2C19 ( ) (Anderson et al) CYP2D6 ( - , ) (Hogstedt et al) CYP3A4 ( , ) (Prevost et al) 22. 23Pennell, Epilepsia, 2002 () (//) 23. pgp BCRP MRP2 AGCCGGGTGGTGTCACAGGAAGAGAT[A/C/G/T]GTGAGGGCAGCAAAGGAGGCCAACA ABCB1 3435TT + ABCB1 3435C/T P- (pgp) Bliek et al. 2009 13 3,6 0 2 4 6 8 10 12 14 / OR 6.2 (pG P- (pgp) : TGAAAGATAAGAAAGAACTAGAAGGT[A/G/T]CTGGGAAGGTGAGTCAAACTAAATA : Spina bifida / - , Atkinson et al. 2007 25. , 26. 27. www.motherisk.org 28. 0 10 20 30 40 50 60 70 , 62 4 34 % .. . 29. N = 1082 - N = 556 N = 380 N=146 . % . % . % . % 192 17,7 99 17,8 68 17,9 25 17,1 656 60,6 337 60,6 236 62,1 83 56,8 145 13,4 61 11,0 56 14,7 28 19,2 1 90 8,3 59 10,6 20 5,3 10 6,8 1 , , , , , 12 , , -, , , .., .. . 2011 2 . 30. , , 3-4 ( ), , , , . 31. ? 32. FDA , ( , ) , ( , ) 33. 34. 35. FDA . , = = = / . : - 1 36. , , ! 37. ! 38. ( 304 ): , , , , 60,5% (620 ) 23,9% 33% 27,5% 30,6% .., ... 39. 73,7% 23,5% 2,8% 61,1% 7,1% 28,8% 3% 232 (31,8% ) , 93 (40,1%) 40,1% - .., .. . 40. 73,7% 28,8% ( ) 68,4% 31,6% 45,5% 15,6% 39,1% .., .. . 41. , 11% 36%26% 17% 10% 47% (479 ) .., .. . 42. 43. 44. 100 / 70 , (, ) An-Tai-Yin Huanglian (Chuang et al, 2006) , 2009 45. ? 46. GPP Good Pharmacovigilance Practice 47. : 48. 49 1979 . 1985 .- Motherisk (www.motherisk.org) 1990 .- Park City, Utah OTIS (www.otispregnancy.org) 13 ENTIS (www.entis-org.com) 1994 . Reportox (www.reprotox.org) 2011 . OTIS FDA (www.otis- pregnancy.org) 49. 50. 51. , 30 25 15 23 7 8 17 20 3 45 30 223 52. (, , ) - , - Schaefer et al., 2008 53. : ( .. 1500 ) (ENTIS, OTIS, RUTIS???) 54. , -, (, , , , -, , ( ), , ) - ,,, , ., - ! , , - . - 5 &lt; 14,4% &gt;5 26,8% 8 &gt; 50% .., .. . 2011 55. , (469 ) 23,9% 9,6% 6,0%9,9% 13,4% 29,8% .., .. . 56. 57. .! , : (Y40-Y59) - , , 58. - 59. ; - ; ; 60. ; ; ; ! 61. ! ksenia.zagorodnikova@gmail.com pregpharm@gmail.com +79312082392 +7(812)5430522 </p>

Recommended

View more >