Chuyển hóa acid nucleic

  • Published on
    16-Jul-2015

  • View
    536

  • Download
    7

Embed Size (px)

Transcript

<ul><li><p>Trao i trc tuyn ti: </p><p>http://www.mientayvn.com/Y_online.html </p></li><li><p>CHUYEN HOA ACID NUCLEIC</p></li><li><p>#MUC TIEU1. Viet c s o chi tiet cua s thoai hoa base purin</p><p>2. Neu c cac bc trong qua trnh tong hp purin va pyrimidin nucleotid</p><p>3. Neu c cac chi tiet ve benh gut</p><p>4. Mo ta c s tong hp ADN hay s nhan oi ADN</p><p>5. Mo ta c s tong hp ARN hay s chuyen ma</p><p>6. Phan biet c s khac biet gia s chuyen ma te bao nhan s va s chuyen ma te bao nhan thc.</p></li><li><p>#NI DUNG1.THOI HA ACID NUCLEIC</p><p> i cng v thoi ha acid nucleic Thoi ha nucleotid purin Thoi ha nucleotid pyrimidin </p><p>2.TNG HP ACID NUCLEIC</p><p> Tng hp nucleotid purin Tng hp nucleotid pyrimidin Tng hp DNA Tng hp ARN</p></li><li><p>#</p></li><li><p>#</p></li><li><p>#</p></li><li><p>#</p></li><li><p>#</p></li><li><p>#1. THOAI HOA ACID NUCLEIC1.1. S o tong quat</p><p>Acid nucleic (ADN, ARN)H2O Nuclease</p><p>NucleotidPvc Nucleotidase</p><p>NucleosidNucleosidase</p><p>Base N + Pentose</p></li><li><p>#Base N + Pentose</p><p>Purin Pyrimidin </p><p>Acid uric NH3 , CO2</p><p>Ure</p></li><li><p>#1.2. Thoai hoa base purin</p><p>nucleosidase Xanthin oxidase</p><p>2 loi phn ng ch yu: kh amin thu phn v oxy ho</p><p>ADA deficiency</p><p>(ADA)</p></li><li><p>#H</p><p>Xanthin oxidase</p><p>Xanthin </p><p>oxidase</p></li><li><p>#</p></li><li><p>#NgiChim Acid uric NT</p><p>Mot so bo sat San pham </p><p>thoai hoa cuoi cungMot so bo sat khac</p><p>a so V co vu AlantoinNhuyen the </p><p>Uricase</p></li><li><p># Sn phm thoi ha cui cng ca purin khc nhau gia cc</p><p>loi.</p><p> a s cc loi V c v, acid uric c chuyn thnh</p><p>allantoin tan trong nc nh uricase.</p><p> ngi, thiu uricase nn sn phm cui cng ca thoi</p><p>ha purin l acid uric.</p></li><li><p>#Bnh thng:-Acid uric/mau 3 6 mg%-Acid uric /NT 500-800 mg/ 24 gi</p><p>Benh gut (goutte, gout, thong phong): Acid uric/mau : &gt;10mg% 15-20mg% Co tinh the Natri Urat sun, xng ac biet la cac khp Viem khp cap</p><p> Soi ng tieu.</p></li><li><p>#</p></li><li><p>#1.3.Thoai hoa base PyrimidinChu yeu gan</p></li><li><p>#</p></li><li><p>#</p></li><li><p>#-Aminoisobutyrate l tin </p><p>cht to thnh Succinyl-CoA</p><p>CoA</p></li><li><p>#2.TONG HP ACID NUCLEIC</p><p>Nguyen lieu:H3PO4: t thc anRibose: t con ng HMP----&gt;Ribose-5- PBase N: c the tong hp.</p><p>Hai con ng : </p><p> Con ng tng hp mi (de novo pathway) : t nhng tincht chuyn ha (acid amin, ribose 5-P, CO2, NH3 )</p><p> Con ng tn dng (salvage pathway) : ti s dng base nitv nucleosid t do gii phng t qu trnh thoi ha acidnucleic.</p></li><li><p>#2.1.Tong hp Purin va Purin NucleotidPurin nucleotid : AMP, IMP,GMP.</p><p>T base PurinQua 2 con ng</p><p>T Ribose-5- P</p><p>Deoxyribonucleotid c to thnh t ribonucleotid nh s kh oxy</p></li><li><p>#Hai con ng tng hp purin nucleotid</p></li><li><p>#</p></li><li><p>#3 giai on:</p><p>G 1: Tng hp PRPP t ribose-5-P</p><p>G 2: Tri qua nhiu p to thnh IMP</p><p>G 3: To thnh AMP v GMP t IMP</p><p>TH purin nucleotid t ribose 5-phosphat</p></li><li><p>#GIAI ON 1 :To thnh 5-phosphoribosyl-1-pyrophosphate(PRPP) </p><p> 5-phosphoribosyl 1 Pyrophosphate</p></li><li><p>#GIAI ON 2 : To thnh IMP t PRPP </p></li><li><p>#GIAI ON 3 : To thnh AMP v GMP t IMP</p><p>Adenine ribose-P</p><p>Guanine ribose-P</p></li><li><p># Gm 3 c ch c chngc (c ch enzym) 3 G</p><p> G3 :</p><p>IMP AMP cn c GTPIMP GMP cn c ATP s tng hp 2nucleotid ny c khuynhhng cn bng.</p><p>1</p><p>2</p><p>3</p><p>IU HA TNG HP PURIN NUCLEOTID</p></li><li><p>#HGPRT</p><p>TH purin nucleotid t vic ti s dng base nit v nucleosid t do </p><p>Allopurinol allopurinol ribonucleotid bt hot (*)</p><p>Trong HC Lesch-Nyhan: hot tnh HGPRT gim (*) khng xy ra, nn allopurinol khng c tc dng.</p><p>PRPP</p><p>HGPRT</p></li><li><p>#BNH GT NGUYN PHT</p><p>PRPP synthase tng hot tnh hoc HGPRT khim khuyt:</p><p> tng to purin nucleotid tng acid uric/mu</p></li><li><p>#Dung pp ong v vi 14C va 15N xac nh c nguon goc cac nguyen t trong nhan Purin:</p></li><li><p>#2.2. Tong hp Pyrimidin va Pyrimidin nucleotid2 giai oan:</p></li><li><p>#dUMP</p><p>dTMP</p></li><li><p>#</p></li><li><p>#d</p><p>1</p><p>2</p><p>Megaloblastic anemia: do thiu CTP, TMP, UTP gim sn xut HCiu tr bng Uridin</p></li><li><p>#IU HA TNG HP </p><p>PYRIMIDIN NUCLEOTID1</p><p>2</p><p>CTP c ch ngc enzym aspartate transcarbam</p><p>oylase.</p><p>CTP c ch aspartate transcarbamoylase (hnh bn)UMP c ch CAP synthaseTTP khng c vai tr trong c ch ngc trn s tng hp pyrimidin</p></li><li><p>#Nhiu thuc dng trong iu tr (ho tr K) tc dng ln enzym ca qu trnh tng hp nucleotid</p></li><li><p>#Nguon goc cac phan t tren Pyrimidin:</p></li><li><p>#</p></li><li><p>#1</p><p>3</p><p>4</p><p>6</p></li><li><p>#2.3. Tong hp cac deoxyribonucleotidkh oxy C2</p><p>Ribonucleotid Deoxyribonucleotid Qua trnh khac nhau cac loai:*E.coli:</p><p>NDP dNDP</p><p>*Lactobacillus:NTP dNTP</p><p>*Tong hp cac dNTP t dNDP:dNDP dNTP</p><p>ATP ADP</p></li><li><p>#KH RIBONUCLEOTID THNH DEOXYRIBONUCLEOTID</p><p> Kh nhm 2-hydroxyl ca ribonucleotid diP</p><p> Phc hp enzym ribonucleotid reductase</p></li><li><p>#S tao thanh cac Nucleosid di va triphosphat:Bng p phosphoryl ha</p></li><li><p>#2.4. Tong hp ADN2.4.1.S nhan oi ban bao ton- Mo hnh: cau truc xoan oi- Watson va Crick: gia thuyet ve c che ban </p><p>bao ton cua s tong hp ADN.</p></li><li><p>#</p></li><li><p>#2.4.2.Cau truc chac ba cua ADN (replication fork)</p></li><li><p>#</p></li><li><p>#2.4.3.Qua trnh nhan oi ADNt nhat 20 enzym va yeu to Protein tham gia </p><p>he thong Replicase (Replisom) hoat ong vi toc o rat nhanh va rat chnh xac:</p><p>Tien chat: 4 loai dNTP</p><p>Bo may nhan oi </p></li><li><p>#Qua trnh nhan oi ADN, 5 giai oan:1. Nhan biet iem m au va thao xoan tach </p><p>biet 2 si ADN me (he thong Replicase)</p><p>2 loai protein chnh tham gia qua trnh nay: </p><p>ADN helicase, tach ri hai si</p><p>Protein gan ADN si n (single strand DNA binding protein hay SSB protein), gi cho 2 si ADN n trang thai ri nhau va on nh</p></li><li><p>#</p></li><li><p>#</p></li><li><p>#2. Tao ARN moi nh primasePrimase ket hp ADN helicase tao primosom</p><p>3.Tong hp hai si ADN mi nh ADN polymerase (ADN Polymerase III)-si dan,</p><p>-si sau oan Okazaki</p><p>4. Loai ARN moi nh ADN polymerase I. Sau o cac oan ADN mi tiep tuc c keo dai.</p><p>5. Noi nhng oan ADN mi nh ADN ligase</p></li><li><p>#</p></li><li><p>#</p></li><li><p>#2.4.4. Sa cha ADN :E.coli, t le sai sot 1/109 1010 nucleotid.Nh ADN polymerase I va III co the lui lai </p><p>tach va loai bo nucleotid sai, gan nucleotid ung.</p><p>ARN polymerase khong co tac dung t sa cha.</p><p>S nhan oi ADN tb nhan that va tb nhan s eu tng t nh nhau.</p></li><li><p>#</p></li><li><p>#2.5.Tong hp ARN (S chuyen ma)</p><p>CCCACAGCCGCCAGTTCCGCTGCGCATTTT</p><p>ADN-si m ha</p><p>GGGTGTCGGCGGTCAAGGCGACGCGTAAAA</p><p>ADN-si khun</p><p>CCCACAGCCGCCAGUUCCGCUGCGCAUUUU</p><p>ARN m</p></li><li><p>#2.5.1. tb nhan sa. Giai oan khi au:ARN polymerase: Holoenzym: 2.Enzym loi (core enzyme): 2</p><p>Tieu n v se tm mot iem co gen khi ong</p></li><li><p>#</p></li><li><p>#S tong hp ARN khong can mot oan moi. au 5 cua nhng chuoi ARN mi eu bat au bang </p><p>pppG hoac pppA.S tong hp ARN xay ra theo chieu 5 3, giong s </p><p>tong hp ADN.</p><p>b. Giai oan keo dai:</p></li><li><p>#ARN Polymerase khong co hoat tnh nuclease. Mc o sai sot cua s tong hp ARN la 1/104 hoac 1/105</p><p>c. Giai oan ket thuc</p></li><li><p>#ieu chnh ARN: ARNm c ieu chnh rat t hoac khong can ieu </p><p>chnh sau khi ARN c tong hp. Mot so ARN c giai ma ngay trong qua trnh chuyen ma. </p><p> tien ARNt va tien ARNr:- b cat oan bi nuclease va c ieu chnh thanh </p><p>nhng si ARN mi. - them mot so nucleotid vao au ARN.V du, CCA </p><p>c them vao au 3 cua mot so phan t ARNt nao cha co san trnh t chuoi nay au.</p><p>- thay oi ve base va ribose cua ARNr. mot so base c methyl hoa ;</p><p>- tao base hiem ARNt</p></li><li><p>#</p></li><li><p>#2.5.2. te bao nhan that:a. S chuyen ma va giai ma phan cach nhau ve khong </p><p>gian vathi gian Xay ra trong nhan. </p><p> Tao ra rat nhieu ARN sau nay se thanh ARNm. </p><p> Nhng ban sao tien phat can co mot cai chop au 5 va mot uoi polyA au 3. </p><p> Hau het cac tien ARNm te bao co nhan that bac cao eu c qua mot qua trnh cat noi (splicing).</p></li><li><p>#</p></li><li><p>#</p></li><li><p>#</p></li><li><p>#</p></li><li><p>#b. ARN te bao co nhan thc c tong hp bi 3 loai ARN polymerase</p><p>Loai V tr Ban sao I Hach nhan ARNr 18S, 5.8S va28S </p><p>II Nhan chat tien ARNm va ARN hn </p><p>III Nhan chat ARNt va ARNr 5S </p></li><li><p>#c. Nhng gen khi ong te bao nhan thc co cha mot hop TATA va co them nhng trnh t chuoi ngc dong</p><p>-----------5 TATAAAA 3---------+1---------25</p><p>Hop TATA</p><p>d. Co nhng protein ac hieu c goi la nhng yeu to chuyen ma (transcription factors) tng tac vi nhng gen khi ong te bao co nhan thc</p></li><li><p>#e. Nhng chuoi tang cng (enhancer sequences) co the kch thch s chuyen ma cach iem khi au hang nghn base</p><p>f. Tien ARNm c gan chop au 5 trong qua trnh chuyen ma Tien ARNm: </p><p>- chop 7-methylguanosin au 5 - uoi polyadenylat, dai khoang 250 goc A, au 3.- khi b mat uoi polyA, no c chuyen ra khoi nhan va c dung lam khuon cho s tong hp protein.</p><p> ARNt va ARNr : khong co chop.</p></li><li><p>#g. Nhng iem cat noi cua tien ARNm th c xac nh achieu bi nhng trnh t chuoi cuoi intron</p><p> Cat loai chnh xac intron khoi tien ARNm. Trnh t chuoi cua mot intron: </p><p>GU AG. </p><p> Thalassemia: - do mot s cat noi sai gay nen. - hau qua: ARNm c tao ra se cha mot loat nhng mama bnh thng th khong thay hien dien.</p><p>au 3 bnh thng cua intron</p><p>Bnh thng5CCTATTGGTCTATTTTCCACCCTTAGGCTGCTG 3</p><p>-thalassemia </p><p>5CCTATTAGTCTATTTTCCACCCTTAGGCTGCTG 3</p></li></ul>